| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.040340 |
| Chromosome: | chromosome 2 |
| Location: | 1325371 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082700 | COX15 | Mitochondrial cytochrome c oxidase assembly factor; (1 of 1) K02259 - cytochrome c oxidase assembly protein subunit 15 (COX15) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCTGATGGGTTGCTGGCAGGCACCCAGCTACCAACAACACAGCACTA |
| Internal bar code: | GAGTTGATTGTTAGTTGCCCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 203 |
| LEAP-Seq percent confirming: | 43.4783 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCTCCCCACATCTACCCC |
| Suggested primer 2: | TGGGTCCGAATCAGGGGTAT |