| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.040370 |
| Chromosome: | chromosome 16 |
| Location: | 5236480 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684400 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACACAACGCGTGGGGGCGGCTCCGCTGAGGGAGCGGCGGCCGCCTGC |
| Internal bar code: | CAGAAATCCAGGGCGAGAATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1595 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCATGACTACCACCCGTA |
| Suggested primer 2: | CTCCTCCATCTCCTCCCCAA |