| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.040445 |
| Chromosome: | chromosome 3 |
| Location: | 8921778 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204801 | (1 of 1) K10606 - E3 ubiquitin-protein ligase FANCL (FANCL, PHF9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTCCGGCTGGTCGACGGCTGCGGCCGCGAGCACCAGTTGCGACTCAG |
| Internal bar code: | TCACGGGGGGGAGATCGGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2541 |
| LEAP-Seq percent confirming: | 60.8696 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTGCGGTCGATGTCTTC |
| Suggested primer 2: | CTACGGGCAGTACCTCCAAC |