| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.040462 |
| Chromosome: | chromosome 2 |
| Location: | 7427402 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392245 | DPMS3,DPM3 | (1 of 1) PF08285 - Dolichol-phosphate mannosyltransferase subunit 3 (DPM3) (DPM3); Dolicol-phosphate mannosyltransferase 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACTATACCACCAATTGTCCCGGACAACACTCAGCAGCCGGGACACGAT |
| Internal bar code: | CCATGTGTTAGGACAAAAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3475 |
| LEAP-Seq percent confirming: | 98.2609 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 115 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGCCCCCAGGAAATTGTC |
| Suggested primer 2: | TCAGCAGGCCCTAAACCATG |