| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.040628 |
| Chromosome: | chromosome 3 |
| Location: | 6850774 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197550 | TMEM48,NDC1 | (1 of 1) K14315 - nucleoporin NDC1 (NDC1, TMEM48); Nuclear pore protein NDC1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGCACTTGGATTTCGCTCTTCTTGACACGCGTGGTCGTGCGCGGGC |
| Internal bar code: | TGGCAGGAGTGCAACGACTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4087 |
| LEAP-Seq percent confirming: | 86.5854 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAGCCTCTCTGTGAACA |
| Suggested primer 2: | CGTCAGGCATCATTCAAGCG |