| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.040641 |
| Chromosome: | chromosome 7 |
| Location: | 275346 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314000 | (1 of 1) PF16156 - Domain of unknown function (DUF4864) (DUF4864) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCAGCCACCAGGCTGACGCCGTCCACCATCCAGCAGCCCTGGAAGGG |
| Internal bar code: | CGGGCCACGGAGTGGCTTAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 264 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGCGGGATCTGTATGGC |
| Suggested primer 2: | GTGGACCAGGTTGACTAGCC |