| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.040693 |
| Chromosome: | chromosome 16 |
| Location: | 3588300 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670261 | (1 of 1) K15305 - vacuole morphology and inheritance protein 14 (VAC14, TAX1BP2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGTGAGGCGCGCCGGCGGCACCATATCCAGCACCCGCACCTGCAGCC |
| Internal bar code: | GTAGCCGTAGTGCTGCCTACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3202 |
| LEAP-Seq percent confirming: | 98.913 |
| LEAP-Seq n confirming: | 91 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 92 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTCTCAGTGGACAGTCG |
| Suggested primer 2: | CGGCAATCACAACACAAGCA |