| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.040757 |
| Chromosome: | chromosome 17 |
| Location: | 2870353 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718850 | RFA1,RPA70A | (1 of 1) PTHR23273//PTHR23273:SF12 - REPLICATION FACTOR A 1, RFA1 // REPLICATION PROTEIN A 70 KDA DNA-BINDING SUBUNIT C-RELATED; Replication protein A, 70 kDa DNA-binding subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAATATGCCCCACGGAACATACACACACACACACACACACTCCCCTGC |
| Internal bar code: | CCCTTGCCGTAGATACTATAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1537 |
| LEAP-Seq percent confirming: | 54.2857 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACACCAATTTGCATGCC |
| Suggested primer 2: | TAGTCCTGGCCAGTTGCATG |