Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.040781 |
Chromosome: | chromosome 3 |
Location: | 3990962 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171550 | SSA13 | cilia-sensing, structure and/or assembly; (1 of 1) PTHR21706//PTHR21706:SF15 - FAMILY NOT NAMED // TRANSMEMBRANE PROTEIN 65 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAAGGAACTGCAGACCCCCTACTGCAACGGTGCCTGGTGCGCAAGCA |
Internal bar code: | ACTGGGGGTTTGAAAACTCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3668 |
LEAP-Seq percent confirming: | 98.9247 |
LEAP-Seq n confirming: | 92 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 93 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGCCTACCATGATTGCA |
Suggested primer 2: | CAACCCTTTTGCCAACTCCG |