| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.040855 |
| Chromosome: | chromosome 6 |
| Location: | 7511943 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g301050 | ARL13B,ARL13 | (1 of 1) K07962 - ADP-ribosylation factor-like protein 13B (ARL13B, ARL2L1); ARF-like GTPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACCCTCGCGTGCAAACGGAGGCGGAGGAGGTGCGGCAGGAGGAGGCC |
| Internal bar code: | GGAGTCCGCCTATTTCTGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2635 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTGTCCTCACCTCTCGA |
| Suggested primer 2: | AGGGACAACTGCGATCACTG |