| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.040872 |
| Chromosome: | chromosome 5 |
| Location: | 2999001 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g230800 | (1 of 1) PF00176//PF07496 - SNF2 family N-terminal domain (SNF2_N) // CW-type Zinc Finger (zf-CW) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTTATCTAATGATGTGAAGGCGTAGGAGGGGGGCGGCAGGTCTGGGC |
| Internal bar code: | GTCTTTTGTGCATCTTTGATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 798 |
| LEAP-Seq percent confirming: | 78.5714 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCGATGATGCGGATGAT |
| Suggested primer 2: | GGCCCAAGAATTCTCAACGC |