| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.040880 |
| Chromosome: | chromosome 14 |
| Location: | 3114225 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628450 | CYN48,CYN1b,CYN1 | Cyclophilin 48; (1 of 2) IPR002130//IPR029000 - Cyclophilin-type peptidyl-prolyl cis-trans isomerase domain // Cyclophilin-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGATAAGGAACTCACAGAACTTGCAGGAGGGGCAGTTCCCCTTTTGCGC |
| Internal bar code: | GTGTATTCCCATAGGTCTTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3233 |
| LEAP-Seq percent confirming: | 80.4878 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTTGCATTGCTGTGAA |
| Suggested primer 2: | AACACCAGCCCTTAGTCAGC |