| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.040929 |
| Chromosome: | chromosome 3 |
| Location: | 3631249 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168300 | (1 of 1) 3.4.21.107//3.4.21.108 - Peptidase Do / Protease Do // HtrA2 peptidase / Serine proteinase OMI | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCTGCCGGCGAGTTCTCCGGGTTCCAATACAGCACGTCCTCCAACAC |
| Internal bar code: | GACTCCTGCTAGCAGGACCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2728 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAGGGAGAGACTAGCCCA |
| Suggested primer 2: | AAGACACGAGGCGGAACATT |