| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.041019 |
| Chromosome: | chromosome 16 |
| Location: | 5036082 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686000 | SRS15 | (1 of 1) K13096 - splicing factor 4 (SF4); putative RNA-binding protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTGTGCCAAACCCTCCTGTAAACCCTAACCCCCCAAAACACACGCAC |
| Internal bar code: | AAGGGTTGCTTAAGCGGGCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACATACACACGCACG |
| Suggested primer 2: | AACAAAGATTTGCACCCCGC |