| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.041116 |
| Chromosome: | chromosome 12 |
| Location: | 1482780 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488050 | FFT5 | putative fructan fructosyltransferase; (1 of 1) 2.4.1.99//3.2.1.26 - Sucrose:sucrose fructosyltransferase / Sucrose:sucrose 1-fructosyltransferase // Beta-fructofuranosidase / Saccharase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCAGCCCATCGGAGCACCATTGCCGGCCCGGAACCTGCCCAGGGAAC |
| Internal bar code: | GTGTGCCCTGGCATTAGAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4169 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGGCTGGTGGTAAGCAT |
| Suggested primer 2: | AAAGCGTCTCACACTGCTCA |