| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.041124 |
| Chromosome: | chromosome 5 |
| Location: | 828692 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g246050 | OTU3 | (1 of 1) K13717 - OTU domain-containing protein 3 [EC:3.4.19.12] (OTUD3); OTU-like cysteine protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGACGGCACGTGGGCTGGCTACATGGAGGTGGTGGCGGCGTCCCGGTGC |
| Internal bar code: | CGATACAGGGATGAAAGATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 79 |
| LEAP-Seq percent confirming: | 4.54545 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTAGATGGGGTGGGATGT |
| Suggested primer 2: | CGACTTGACCTCACCGAACA |