| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.041126 |
| Chromosome: | chromosome 15 |
| Location: | 190908 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g634701 | DIV20,RECQ4 | (1 of 1) K10730 - ATP-dependent DNA helicase Q4 [EC:3.6.4.12] (RECQL4); RecQ-class helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAAACCCAATGCAATAGAGCGAGGAGGAGAGCGTGGGCGATGCTTGAC |
| Internal bar code: | TGACTCTCGGGATTAGCGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 450 |
| LEAP-Seq percent confirming: | 81.8182 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTATGTTGGCAGTGAGCT |
| Suggested primer 2: | AACCCTATCACTCCTCCCCC |