Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.041267 |
Chromosome: | chromosome 16 |
Location: | 6295112 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676100 | (1 of 1) IPR000210//IPR006502//IPR011333//IPR011705 - BTB/POZ domain // Protein of unknown function PDDEXK-like // POZ domain // BTB/Kelch-associated | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATTCAAAGGTTATCATCAGGATCGTCGCAAGCTTGGAAGGCCAAGAG |
Internal bar code: | CGGGCGTCGCAAATCCCAGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3034 |
LEAP-Seq percent confirming: | 82.3529 |
LEAP-Seq n confirming: | 42 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGAGGAGAGTGCCCAGTG |
Suggested primer 2: | GACATCGGTGGATAGCTGCA |