| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.041387 |
| Chromosome: | chromosome 1 |
| Location: | 876279 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g004950 | (1 of 2) 4.2.1.130 - D-lactate dehydratase / Glyoxylase III; Conserved Protein with Putative intracellular protease/amidase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGGTGCGGGCCTCCAACCTCTCACATCCCTATCTCAACTCTGCCTCT |
| Internal bar code: | CTGAAATGTAAAGCGATGACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2710 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCAAGAGAGCTAGCAACA |
| Suggested primer 2: | CGTTGCGCAGGGTATAAACG |