| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.041481 |
| Chromosome: | chromosome 14 |
| Location: | 2554287 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g624900 | FAP171 | Flagellar Associated Protein 171; (1 of 5) IPR000104//IPR016024 - Antifreeze protein, type I // Armadillo-type fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGCGTGACGGCTCGTCATGCGAGGTGGAGGGTTGCTGGCGCATGATA |
| Internal bar code: | TATCAAGGGAAACCGAGATTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2912 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGATCTCGAGTCGCAGC |
| Suggested primer 2: | CGTGTGGCTGCAACATTTGA |