Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.041481 |
Chromosome: | chromosome 14 |
Location: | 2554287 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g624900 | FAP171 | Flagellar Associated Protein 171; (1 of 5) IPR000104//IPR016024 - Antifreeze protein, type I // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGCGTGACGGCTCGTCATGCGAGGTGGAGGGTTGCTGGCGCATGATA |
Internal bar code: | TATCAAGGGAAACCGAGATTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2912 |
LEAP-Seq percent confirming: | 98.4615 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGATCTCGAGTCGCAGC |
Suggested primer 2: | CGTGTGGCTGCAACATTTGA |