Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.041516 |
Chromosome: | chromosome 16 |
Location: | 7534391 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683035 | (1 of 2) IPR003593//IPR027417 - AAA+ ATPase domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGCCGCTGCTGAGGTGCCGAACAAGGTCCTTCGTGCTCCTGCTGCGG |
Internal bar code: | CACTTAAAAGGGCTACAAAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2767 |
LEAP-Seq percent confirming: | 78.481 |
LEAP-Seq n confirming: | 62 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGATGGCGGTGGTGTTCA |
Suggested primer 2: | AGAGATACATCGCCAGCACG |