Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.041549 |
Chromosome: | chromosome 2 |
Location: | 5650643 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g115650 | FBA4 | (1 of 2) PTHR11627//PTHR11627:SF20 - FRUCTOSE-BISPHOSPHATE ALDOLASE // FRUCTOSE-BISPHOSPHATE ALDOLASE; Fructose-1%252C6-bisphosphate aldolase | 3'UTR |
Cre02.g115700 | intron | ||
lncRNA_TCONS_00042975 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGCACTCACAGGTATTCGCTGCCAGCGATACAACCTTCATCAACCAG |
Internal bar code: | GTATCAGGATCTCTACGGATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5890 |
LEAP-Seq percent confirming: | 92.6471 |
LEAP-Seq n confirming: | 63 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATACTACCCACACCGCCCA |
Suggested primer 2: | TCCCAATACATCGCTCGCTC |