Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.041572 |
Chromosome: | chromosome 11 |
Location: | 2517359 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095103 | GT90-34,GT90F34 | GT90 family protein 34; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTAACTCCCGCGCCGTCTGGGCGGGCTTCCTTTTGTGGTTCTTTTAACA |
Internal bar code: | AAGACGCTATAACCCACCAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4351 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 82 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTCAAATGCGCACACAGG |
Suggested primer 2: | GCACACCGTACCAAAACCAC |