| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.041597 |
| Chromosome: | chromosome 10 |
| Location: | 6166146 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g462500 | PUS16 | (1 of 1) 5.4.99.42 - tRNA pseudouridine(31) synthase; RNA pseudouridine synthase | intron |
| Cre10.g462550 | (1 of 34) IPR001878 - Zinc finger, CCHC-type | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCTCCAGGGCGGGTGAGAGGCTGCATAATAGAAACGCAAATGGGCGA |
| Internal bar code: | TTTCCCTACGTTCGCGTTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2143 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCACCCCTACTCCTGCT |
| Suggested primer 2: | CCGCAAGTACTCCCACAACT |