Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.041604 |
Chromosome: | chromosome 16 |
Location: | 704970 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g691353 | (1 of 14) PF13371 - Tetratricopeptide repeat (TPR_9) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTAGGGTCCACGGCCAACAGCTTCTCGAAAGAGGATGAAGCAGCGTCG |
Internal bar code: | CGAAGGACGTTCGATTAGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1875 |
LEAP-Seq percent confirming: | 63.7681 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGCTTTCAAACGCTGAACA |
Suggested primer 2: | CCTGTGCTCCCCTAGTTTGG |