| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.041666 |
| Chromosome: | chromosome 3 |
| Location: | 5082414 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180200 | (1 of 12) IPR001680//IPR015943//IPR017986 - WD40 repeat // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCTCCGCAAGTGCTGTTTATTGCCGAAACAGACCAAAGCGTCACTACC |
| Internal bar code: | ATATTAGTGATACCGCTATTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4294 |
| LEAP-Seq percent confirming: | 98.2143 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGGATTCCGGATTTTGC |
| Suggested primer 2: | AGGGTCTGAAGTCGGTCGTA |