Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.041677 |
Chromosome: | chromosome 7 |
Location: | 2923282 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g332700 | (1 of 1) PF00069//PF13639 - Protein kinase domain (Pkinase) // Ring finger domain (zf-RING_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGACTCGAAACCTTTGCCATCCAACAGTCGGCAGTCGCTGACGCCGAC |
Internal bar code: | ACTAGCAACAACTGTGTTCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 162 |
LEAP-Seq percent confirming: | 7.69231 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACACACACACACATGCAC |
Suggested primer 2: | GCAGCTTGGTGACACTAGGT |