| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.041680 |
| Chromosome: | chromosome 7 |
| Location: | 6359222 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g357350 | GLB1,PII | Nitrogen regulatory protein PII; (1 of 1) PTHR30115:SF11 - NITROGEN REGULATORY PROTEIN P-II HOMOLOG | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCTCTTACTCATACACACTACTACATACAAGCTCCACACACGTACCC |
| Internal bar code: | TCCATTACCCGTCTATTTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 47 |
| LEAP-Seq percent confirming: | 2.63158 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTACTTGGACAGGGTGTC |
| Suggested primer 2: | GAGCCACTCCCGTTTACACA |