| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.041695 |
| Chromosome: | chromosome 10 |
| Location: | 2036127 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g432500 | CND1 | Condensin complex component; (1 of 1) K06677 - condensin complex subunit 1 (YCS4, CNAP1, CAPD2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACATGACCAAGCCGAAGGGCCACATGGCACAAGTGGCGCGCTGCCTGG |
| Internal bar code: | GGACTACTCTGAGCAGTAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1021 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACGACACGATACGGTACC |
| Suggested primer 2: | CCTCGCACTGCAGTACTTCA |