Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.041728 |
Chromosome: | chromosome 2 |
Location: | 6644806 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389900 | HRP4 | Hydroxyproline-rich glycoprotein; (1 of 1) PTHR15744//PTHR15744:SF0 - BLOM7 // UPF0469 PROTEIN KIAA0907 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTACTGACTTATGCGGAGCCCGCCGGGGCCCACACACGCGCGCAAGC |
Internal bar code: | TGCGATAGGGGTCTTCGTCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 539 |
LEAP-Seq percent confirming: | 90.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGACAAGATCAAGGGGC |
Suggested primer 2: | GAGGCTGCATGGGAGATACC |