| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.041811 |
| Chromosome: | chromosome 13 |
| Location: | 4988020 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g606000 | EFG7 | (1 of 1) PTHR23115//PTHR23115:SF14 - TRANSLATION FACTOR // ELONGATION FACTOR FAMILY PROTEIN; Putative organellar translation elongation factor EFG/EF2 | 3'UTR |
| Cre13.g801583 | (1 of 2) PF00665//PF07727//PF13976//PF14223 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) // GAG-pre-integrase domain (gag_pre-integrs) // gag-polypeptide of LTR copia-type (UBN2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAGCTGCTTGAACTTGACCAGTCCCGAGGACGAGTCATCCATCCTA |
| Internal bar code: | AGCAGTTTGCGCAAGTGGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1916 |
| LEAP-Seq percent confirming: | 86.5385 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGGGTTATCGGGCAGCA |
| Suggested primer 2: | GCAGATCTCAACCAGCACCT |