| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.041857 |
| Chromosome: | chromosome 1 |
| Location: | 8076937 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g063632 | (1 of 1) K03660 - N-glycosylase/DNA lyase (OGG1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCAGCACAACGCCCCAGAAGGCGGCGGCAGCGGCGGCGGCCGGCAGG |
| Internal bar code: | CTACTCTTGGCGTTAAGTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2311 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCACCACCGTGTACTCCG |
| Suggested primer 2: | TTTTCAACACTCGCAGCTGC |