| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.041869 |
| Chromosome: | chromosome 12 |
| Location: | 9171300 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g543350 | FDH2,GSNOR2,FDH1 | (1 of 2) 1.1.1.1//1.1.1.284 - Alcohol dehydrogenase / Aldehyde reductase // S-(hydroxymethyl)glutathione dehydrogenase / NAD-linked formaldehyde dehydrogenase; Nitrosoglutathione (GSNO) reductase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATACGGCACCGGTACTCGCCTCGTTTGTTTTGCGTGTGCACAGCCCA |
| Internal bar code: | GTCTCGTCAAGTTTCGATTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5920 |
| LEAP-Seq percent confirming: | 81.0 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCTACCCCGTTATGTAGC |
| Suggested primer 2: | TGGTGGCCTATCTCCTTCCA |