| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.041938 |
| Chromosome: | chromosome 4 |
| Location: | 1671034 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212550 | TTL7 | (1 of 1) K06047 - tubulin---tyrosine ligase [EC:6.3.2.25] (TTL); Tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCGGAGACGTGAAGTCGGGTTGCAAGGTAGCGGGTCGAGGTTAGGAA |
| Internal bar code: | GGTGACTAGGCTACAACGTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1679 |
| LEAP-Seq percent confirming: | 67.3913 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGTGTTGAGCAGCCTGAG |
| Suggested primer 2: | GGTTGCAGCCAGTTTTCAGG |