Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.042042 |
Chromosome: | chromosome 3 |
Location: | 3763672 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g169450 | (1 of 7) IPR000048//IPR027417 - IQ motif, EF-hand binding site // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCAGTGCTTTTCGCTGGCGCTCTGCCTCTTCCTGCACTTTCCACTGC |
Internal bar code: | GTTGGCACTATTTTGCGCATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4159 |
LEAP-Seq percent confirming: | 75.7009 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 107 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGTGCTCAAAGGCAAAGG |
Suggested primer 2: | TCCAGAAACCATACCCGTGC |