Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.042129 |
Chromosome: | chromosome 12 |
Location: | 3044595 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g801387 | (1 of 1) K17867 - diphthamide biosynthesis protein 4 (DPH4, DNAJC24) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGAGGTCCCAAGCCTCCAAGCCCAGCGCCAAAGGCACCCAGGCCTATG |
Internal bar code: | TGATGATGTACTTAACCTAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3754 |
LEAP-Seq percent confirming: | 90.1961 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTCAGCGCACCCATTATG |
Suggested primer 2: | AATGAGCACAGTCTGACGCA |