Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.042167 |
Chromosome: | chromosome 13 |
Location: | 1513461 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g572700 | FAP66,FLA15,IFT144 | Intraflagellar transport protein 144; (1 of 1) PF04053//PF15911 - Coatomer WD associated region (Coatomer_WDAD) // WD domain, G-beta repeat (WD40_3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACAGCTGAAGGACCGCATTGTAGCAAAGCGTTATGCAAATGCCTGAA |
Internal bar code: | GCTGGAATAATCGCCGCGTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2442 |
LEAP-Seq percent confirming: | 85.2941 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCCTGGTCACTTTCCCC |
Suggested primer 2: | TGTATACTGGGAGGGGTGGG |