Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.042200 |
Chromosome: | chromosome 12 |
Location: | 4960084 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g524650 | HDA18,SRTB1,SRTB | (1 of 1) K11414 - NAD-dependent deacetylase sirtuin 4 [EC:3.5.1.-] (SIRT4, SIR2L4); Sir2-like NADH dependent histone deacetylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCCAAATTACTCTGTCCTCGTTAGTTCATTTGATCGTGCTCGCTGAC |
Internal bar code: | ACTTTTCGGCGGCACAAGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1702 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 78 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCCTACGGCGGTACAGAA |
Suggested primer 2: | CGGTTCAAAGCGCAAGTCAA |