| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.042221 |
| Chromosome: | chromosome 1 |
| Location: | 3994764 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026200 | PPR9 | PentatricoPeptide Repeat protein 9; (1 of 6) PF01535 - PPR repeat (PPR) | CDS/5'UTR |
| Cre01.g026250 | AGA1 | Alpha-galactosidase; (1 of 1) 3.2.1.22 - Alpha-galactosidase / Melibiase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAATGCTGGCCCGCATCCCTTTGCGCTTGCATACACATTCTCGTGGGG |
| Internal bar code: | TGGTGTCTCGTAACAAAGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 439 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTTCTGACACCACGGCTC |
| Suggested primer 2: | TGCCAAGCTCAAGAAGGAGG |