| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.042228 |
| Chromosome: | chromosome 12 |
| Location: | 4078106 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516650 | STPK6,STK6 | Serine/threonine protein kinase; (1 of 1) IPR000719//IPR001245//IPR002290//IPR011009//IPR011050//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Pectin lyase fold/virulence factor // Tyrosine-protein kinase, catalytic domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCCAGCCGCACCGGTTCTGACATGGGAGCTAGCATGGACAGTTGCTGG |
| Internal bar code: | AAGGGGGCGGTGATTAGGTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5218 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 127 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 127 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTTCACGTCTCTGGACAA |
| Suggested primer 2: | AATTCCGTCAAGACAGCGGT |