Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.042312 |
Chromosome: | chromosome 3 |
Location: | 6864170 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g197700 | HLM8 | (1 of 1) PTHR13793//PTHR13793:SF100 - PHD FINGER PROTEINS // HISTONE-LYSINE N-METHYLTRANSFERASE ATX1-RELATED; Histone-lysine N-methyltransferase | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCGTGGGTGGCGGCGGCTTCTCCATGTCAGCTGGCCAGTTGGCGAAG |
Internal bar code: | CAAAGAGAGCGCCGTGTGGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3463 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCATTGAGCACGGCCAGAT |
Suggested primer 2: | CAAGTCGTTGTGGCACTTGG |