| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.042397 |
| Chromosome: | chromosome 3 |
| Location: | 3116819 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164550 | FRA2 | BolA-like domain protein; (1 of 1) PTHR12735:SF27 - BOLA-LIKE PROTEIN 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTGACCTGGAAGTGGGCTGCTAAGCGCCACTGCCCCAGTCCGCCCAC |
| Internal bar code: | GAGAATACTTTCTAGACCGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1492 |
| LEAP-Seq percent confirming: | 85.1485 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGGATGCACAGACACAT |
| Suggested primer 2: | TTTGCTCCGTCCTTCACTCC |