| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.042471 |
| Chromosome: | chromosome 2 |
| Location: | 3145457 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g096500 | (1 of 18) 2.7.10.2//2.7.11.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGGTTCGGCACGGCATACCGGTTGGTATGGTTACTCGCCATCGGCCC |
| Internal bar code: | CATGAAATTTTTAGACAAGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2162 |
| LEAP-Seq percent confirming: | 21.2121 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCCGTTCACACACAGGC |
| Suggested primer 2: | GACTCATCACGATCGCACCT |