| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.042504 |
| Chromosome: | chromosome 10 |
| Location: | 2834874 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g439050 | MITC7,MCP7 | (1 of 4) K14684 - solute carrier family 25 (mitochondrial phosphate transporter), member 23/24/25/41 (SLC25A23S); Mitochondrial substrate carrier protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCTGTGCCGTTTGGCCGGGCGCCCTTGGCATACGGTTTGAGGCCGGCC |
| Internal bar code: | GGATTGGTTGGTGGATCATACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2702 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACACGAACCAGCCAATGC |
| Suggested primer 2: | ACCTTCCTTCGCTCAACCAG |