| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.042535 |
| Chromosome: | chromosome 17 |
| Location: | 4495669 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731250 | uS15m,MRPS15 | (1 of 1) K02956 - small subunit ribosomal protein S15 (RP-S15, MRPS15, rpsO); Mitochondrial ribosomal protein S15 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTCTTCTGCGCCACGCAAAGATTACAAACCCGGACATGCACCAGTTA |
| Internal bar code: | TCATCTAGGGAGATTAGACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5887 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAAGTTTGCACACCCACG |
| Suggested primer 2: | GCAGGTCCGTCTGTTAACCA |