Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.042553 |
Chromosome: | chromosome 7 |
Location: | 5179375 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g348750 | (1 of 2) PTHR10794:SF58 - CAAX AMINO TERMINAL PROTEASE FAMILY PROTEIN | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTGTGGTGTCTGCGCGGTCGTGGCCACGCCAACCACCGCCAGCGCCG |
Internal bar code: | AATTCAAGACGCGCGAATATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1978 |
LEAP-Seq percent confirming: | 40.2299 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCGGGCACTAGATGAGCAG |
Suggested primer 2: | CCTGCTCAATGGCCAAACAC |