| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.042556 |
| Chromosome: | chromosome 6 |
| Location: | 5280070 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284450 | PPP24 | (1 of 2) K15731 - carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase [EC:3.1.3.16] (CTDSP); Phosphoprotein phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTGCCCCGAGCACGGTCCGCACGTCGGGCGCGTGCTCCAGCTCGTTG |
| Internal bar code: | AAAGACCAGTGGTATTATATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2087 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCTGAATCTGACCCGCCC |
| Suggested primer 2: | GTGCTGCAACTGCTATACGC |