| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.042568 |
| Chromosome: | chromosome 7 |
| Location: | 991817 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319452 | PHC73 | Putative pherophorin-chlamydomonas homolog; (1 of 2) IPR003072//IPR003882 - Orphan nuclear receptor, NOR1 type // Pistil-specific extensin-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAATCACGCCGTCCGTCTTGGACCCCACCCCCCTCCCCGCCCTTCCCG |
| Internal bar code: | TCTCGATACTAATCGTTTCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1655 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCCACCAAGCCTATTCAC |
| Suggested primer 2: | GGTGAAGGCGAAGGGAGTG |