| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.042630 |
| Chromosome: | chromosome 6 |
| Location: | 1465376 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260350 | DNJ6 | (1 of 1) PF00226//PF14308 - DnaJ domain (DnaJ) // X-domain of DnaJ-containing (DnaJ-X); DnaJ-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTCTTGGTCCGCTACGCTAACGCCCATGCCGGCGTGTTTCACATGCAG |
| Internal bar code: | CGATGCTTTGACGGCTCGTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3620 |
| LEAP-Seq percent confirming: | 97.8723 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAGTTTGTGTTCGCGCCC |
| Suggested primer 2: | GCTCCCTTAACCTGCACCTT |