| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.042671 |
| Chromosome: | chromosome 2 |
| Location: | 6045261 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118801 | GTR | Glycosyl transferase; (1 of 1) 2.4.1.246 - Mannosylfructose-phosphate synthase / MFPS | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACTGCTGCTGACCTTGCGTCTGCTGCCTGCTGCTGGCGTCGCTGCCAG |
| Internal bar code: | TGCAGGGTTTGAGTGCGTATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2225 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATTGTTGGGGCTGACTGA |
| Suggested primer 2: | GTGTAGCTGTTGGGTCCCTC |